freeze-thaw comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Updated 2026-01-09. Numbers and descriptions here follow the published literature rather than marketing material.
Purity assessment relies mainly on reverse-phase high-performance liquid chromatography with ultraviolet detection. Because the peptide lacks a strong chromophore, detection often uses backbone absorbance near 214 nm. Identity is confirmed by mass spectrometry, typically electrospray ionization or matrix-assisted laser desorption, comparing the measured mass against the expected value. Amino acid analysis can verify composition after acid hydrolysis. Diastereomer content and residual counterions are reported less often, although both can influence biological assays.
Lyophilized material is generally stable for extended periods when kept dry at or below minus twenty degrees Celsius. Working solutions are less stable, and common practice is to aliquot and freeze them so that repeated freeze-thaw cycles are avoided. Aqueous solutions are sensitive to pH extremes and to microbial growth, so short-term storage at refrigerator temperature is typical. Oxidation and hydrolysis are the principal degradation routes. Reconstitution with sterile water or a mild buffer is standard, and solutions should be protected from light.
Once dissolved, the peptide is markedly less stable than the dry powder. Aqueous solutions are subject to backbone hydrolysis and to microbial growth when they are handled without sterile technique. Buffered solutions near neutral pH are common for short-term laboratory work, while acidic conditions are sometimes used to improve solubility. Analytical laboratories generally prepare working solutions fresh rather than storing them, and a residual water film left in a reopened vial can seed degradation even when the container appears dry.
Reversed-phase high-performance liquid chromatography is the standard technique for estimating peptide purity. The result is a peak-area percentage, which describes how much of the detected material elutes as the main peak in one run. Mass spectrometry confirms the molecular mass and can reveal truncated, adducted, or otherwise modified species. Amino acid analysis or tandem mass spectrometry can address sequence fidelity when identity is in doubt. None of these measurements, taken alone, establishes that a sample is fit for any specific purpose.
| Property | Value | Notes |
|---|---|---|
| Typical purity report | 95% or higher by HPLC | Area percentage at 214 nm |
| Identity confirmation | Mass spectrometry | Electrospray or MALDI |
| Powder storage | -20 C, desiccated | Protect from light |
| Solution storage | 2-8 C short term | Freeze aliquots for longer |
| Quality document | Certificate of analysis | States method and value |
Published clinical evidence is limited. Most controlled trials were conducted in Russia, enrolled modest numbers of participants, and appeared in Russian-language journals, which restricts independent verification. Reported outcomes include lower anxiety scores, improved attention and memory measures, and changes in fatigue ratings. Reviews written in English note methodological limitations such as small samples and inconsistent endpoints. Whether the compound produces clinically meaningful benefit relative to established anxiolytics is therefore an open question rather than an established finding.
Selank is a synthetic heptapeptide with the sequence Thr-Lys-Pro-Arg-Pro-Gly-Pro. It was designed at the Institute of Molecular Genetics of the Russian Academy of Sciences as a structural analogue of tuftsin, a naturally occurring tetrapeptide fragment of the immunoglobulin heavy chain. The added Pro-Gly-Pro tail was intended to slow enzymatic degradation and extend biological activity. In Russia it is registered as an anxiolytic nasal preparation, while regulators elsewhere have not approved it for clinical use.
Proposed mechanisms centre on modulation of the GABAergic system, with reports of altered expression of genes related to GABA-A receptor subunits and changed monoamine turnover. Some studies describe inhibition of enkephalinase, the enzyme that degrades endogenous enkephalins, which may prolong opioid peptide signalling. Effects on brain-derived neurotrophic factor and on cytokine expression have also been reported. These findings come largely from animal models and small human studies, and the precise primary target remains unresolved.
Development work on the compound began in the 1980s and 1990s at the Institute of Molecular Genetics in Moscow, within the same research programme that produced the peptide Semax. Early investigators sought a tuftsin derivative with improved resistance to enzymatic breakdown and with activity in the central nervous system after peripheral administration. Most of the primary literature from this period was published in Russian, a factor that still shapes how easily the findings can be checked by outside groups.
Naming for this compound is not fully standardised in English sources. The spelling Selanc appears in some transliterations, and catalogue entries may instead list the peptide sequence itself as the identifier. Reference material sometimes groups it with other short synthetic peptides studied for behavioural effects, which can create confusion when citations are compared. Distinguishing the exact sequence from related tuftsin analogues is therefore a practical first step when reviewing any dataset or specification sheet.
dephosphorylation The removal of a phosphate group, PO3−4, from a chemical compound, protein, or other biomolecule, either spontaneously or by enzymatic catalysis. Dephosphorylation is the opposite of phosphorylation; both reactions are common molecular modifications involved in numerous biochemical pathways and processes, including in metabolism, where high-energy bonds to phosphate groups are used to transfer energy between molecules, and in the post-translational modification of proteins, where the phosphorylation state of particular residues can affect the protein's affinity for other molecules or function as a molecular signal.
A change in the genetic structure that is not inherited from a parent, and also not passed to offspring, is called a somatic mutation. Somatic mutations are not inherited by an organism's offspring because they do not affect the germline. However, they are passed down to all the progeny of a mutated cell within the same organism during mitosis. A major section of an organism therefore might carry the same mutation. These types of mutations are usually prompted by environmental causes, such as ultraviolet radiation or any exposure to certain harmful chemicals, and can cause diseases including cancer. With plants, some somatic mutations can be propagated without the need for seed production, for example, by grafting and stem cuttings. These types of mutations have led to new types of fruits, such as the "Delicious" apple and the "Washington" navel orange. Human and mouse somatic cells have a mutation rate more than ten times higher than the germline mutation rate for both species; mice have a higher rate of both somatic and germline mutations per cell division than humans. The disparity in mutation rate between the germline and somatic tissues likely reflects the greater importance of genome maintenance in the germline than in the soma.
==== NATO ==== The foreign secretary, Geoffrey Howe, spoke highly of Heseltine's contribution to NATO and WEU conferences. Heseltine was as angry as Thatcher at the US invasion of Grenada, a Commonwealth country. He wanted warmer relations with the Soviets and was sceptical about the US Strategic Defense Initiative ("Star Wars"), putting in a brief and grudging appearance at Caspar Weinberger's Ditchley Park Conference about the topic in 1985. Heseltine came close to misleading the House of Commons over the meeting of NATO defence ministers at Montebello, Quebec, in October 1983. He stated that no "specific" proposals had been made to update NATO short range and tactical nuclear weapons. In fact a decision had been made in principle to do so. Crick describes Heseltine's answers as "highly disingenuous and deceitful". At the time NATO was claiming to be cutting back on such weapons, and the peace movement was still powerful in Germany where such weapons might be used.
Human and mouse protein kinases in UniProt: classification and index Kinase.Com: Genomics, evolution and large-scale analysis of protein kinases (non-commercial). KinMutBase: A registry of disease-causing mutations in protein kinase domains Archived 2022-06-15 at the Wayback Machine KLIFS (Kinase-Ligand Interaction Fingerprints and Structures) Database -- analysis of kinase structures and kinase-inhibitor interactions KinCore: the Kinase Conformation Resource: A web resource for protein kinase sequence, structure and phylogeny Kinomer: A multilevel HMM library for the classification and functional annotation of eukaryotic protein kinases.
Sources: en.wikipedia.org
The program features engineers and architects from around the world, including Santiago Calatrava; italian structural engineer Mario Salvadori of Columbia University; Danish civil engineer and bridge designer Klaus Ostenfeld, and grandson of civil engineer Asger Ostenfeld; civil engineer Mark Whitby and the innovative Severn Bridge, which deployed box girders; Irish civil engineer Patrick J. Dowling, head of the Department of Civil and Environmental Engineering, Imperial College London; the Severn Bridge was taking much heavy traffic at 4-6 am each weekday morning, the amounts of heavy traffic that it had not been inherently designed for, in the late 1950s to take, and the bridge was strengthened in 1990; David Blockley, head of civil engineering at the University of Bristol, and earthquake protection; the 1989 Loma Prieta earthquake; Colin Taylor, head of civil engineering from 2006-11 at the University of Bristol; the Jinde Bridge; the Japanese Great Seto Bridge opened in April 1988; the Pont de Normandie was twice as large of any previous similar type of bridge, and its 206m towers were completed in July 1993, being 250m longer than the 1993 Yangpu Bridge; French civil engineer Michel Virlogeux, and the project manager Bertrand Deroubaix; tuned mass dampers; Spanish structural engineer Santiago Calatrava, who designed the 1992 Alamillo Bridge and 1991 Lusitania Bridge in Mérida, Spain; Peter Head (civil engineer) of Maunsell Group (now AECOM).
Identify the longest continuous chain of carbon atoms. Name this longest root chain using standard naming rules. Name each side chain by changing the suffix of the name of the alkane from "-ane" to "-yl". Number the longest continuous chain in order to give the lowest possible numbers for the side-chains. Number and name the side chains before the name of the root chain. If there are multiple side chains of the same type, use prefixes such as "di-" and "tri-" to indicate it as such, and number each one. Add side chain names in alphabetical (disregarding "di-" etc. prefixes) order in front of the name of the root chain.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== Protists === Brine pockets harbor a diverse and abundant array of protists that are able to survive in extreme conditions. The most common protists in sea ice are pennate diatoms, which can accumulate in numbers so high that sea ice is visibly discolored brown. Sea ice pennate diatom populations can become very dense, reaching up to 1000 μg of chlorophyll per liter of seawater, compared to a typical maximum of 5 μg/L in the open ocean. Due to their high abundance in sea ice, pennate diatoms can profoundly impact the microecosystem within a brine pocket, such as DMSP production. Although diatoms themselves are not high producers of DMSP overall, because of their high abundance within sea ice, the amount of DMSP produced within sea ice as a cryoprotectant and osmoregulator can be impactful. In addition to pennate diatoms, brine pockets and channels house a variety of flagellates, amoebae, and ciliates. Protist abundance and diversity within a brine pocket/channel is primarily limited to brine pocket/channel structure. Specifically, the size of pores and channels within the ice can limit or encourage the distribution of certain protists and metazoans, with some areas with larger pore sizes having greater abundances of large predatory protists such as ciliates, and other areas with reduced populations of predatory protists due to smaller pore sizes.
Cross-flowing is a passive formation method that involves the continuous and aqueous phases running at an angle to each other. Most commonly, the channels are perpendicular in a T-shaped junction with the dispersed phase intersecting the continuous phase; other configurations such as a Y-junction are also possible. The dispersed phase extends into the continuous and is stretched until shear forces break off a droplet. In a T-junction, droplet size and formation rate are determined by the flow rate ratio and capillary number. The capillary number relates the viscosity of the continuous phase, the superficial velocity of the continuous phase, and the interfacial tension. Typically, the dispersed phase flow rate is slower than the continuous flow rate. T-junction formation can be further applied by adding additional channels, creating two T-junctions at one location. By adding channels, different dispersed phases can be added at the same point to create alternating droplets of different compositions. Droplet size, usually above 10 μm, is limited by the channel dimensions and often produces droplets with a CV of less than 2% with a rate of up to 7 kHz.
Sources: en.wikipedia.org
Purity is usually reported as an HPLC area percentage, most often measured at 214 nm. Identity is confirmed separately by mass spectrometry. A certificate of analysis should state both the method and the observed value.
Dry powder is kept frozen, desiccated, and shielded from light. Dissolved material is aliquoted and frozen to limit freeze-thaw cycles. Short-term refrigerated storage is common for working solutions.
Russia registers it as a prescription nasal product. Most other markets classify it as a research chemical with no approved medical use. Oversight of purity and labeling is consequently minimal in those markets.
Sealed, desiccated storage at -20 °C or colder is the standard recommendation for research-grade material. Vials should reach room temperature before they are opened, which limits condensation. Repeated temperature cycling is discouraged.